recombinant mouse (rm) il- 17a Search Results


92
ATCC rat anti il 4
Rat Anti Il 4, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rat anti il 4/product/ATCC
Average 92 stars, based on 1 article reviews
rat anti il 4 - by Bioz Stars, 2026-02
92/100 stars
  Buy from Supplier

88
R&D Systems rmil 17a f heterodimer
Rmil 17a F Heterodimer, supplied by R&D Systems, used in various techniques. Bioz Stars score: 88/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rmil 17a f heterodimer/product/R&D Systems
Average 88 stars, based on 1 article reviews
rmil 17a f heterodimer - by Bioz Stars, 2026-02
88/100 stars
  Buy from Supplier

91
R&D Systems 1 il 4
1 Il 4, supplied by R&D Systems, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/1 il 4/product/R&D Systems
Average 91 stars, based on 1 article reviews
1 il 4 - by Bioz Stars, 2026-02
91/100 stars
  Buy from Supplier

96
R&D Systems il cf mto il 6 r d systems
Il Cf Mto Il 6 R D Systems, supplied by R&D Systems, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/il cf mto il 6 r d systems/product/R&D Systems
Average 96 stars, based on 1 article reviews
il cf mto il 6 r d systems - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

90
R&D Systems Hematology rmil-12
Rmil 12, supplied by R&D Systems Hematology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rmil-12/product/R&D Systems Hematology
Average 90 stars, based on 1 article reviews
rmil-12 - by Bioz Stars, 2026-02
90/100 stars
  Buy from Supplier

94
Abcam ab216165 cytotox 96 non radioactive cytotoxicity assay promega
Ab216165 Cytotox 96 Non Radioactive Cytotoxicity Assay Promega, supplied by Abcam, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ab216165 cytotox 96 non radioactive cytotoxicity assay promega/product/Abcam
Average 94 stars, based on 1 article reviews
ab216165 cytotox 96 non radioactive cytotoxicity assay promega - by Bioz Stars, 2026-02
94/100 stars
  Buy from Supplier

98
Abcam anti caspase 1
Enhanced processing and secretion of IL-1β and IL-18 in stefin B-deficient BMDMs is <t>caspase-1-dependent.</t> BMDMs from WT and StB KO mice were primed for 4 h with LPS (100 ng/ml), washed, and stimulated with ATP for 20 min (5 mm) to activate the Nlrp3 inflammasome. Cell lysates and culture supernatants were immunoblotted with the indicated antibodies. Anti-caspase-1 and anti-caspase-11 antibodies recognized pro-caspase (inactive zymogen) and subunits generated by proteolytic cleavages. Anti-IL-1β and anti-IL-18 antibodies recognized inactive pro-form in cell extracts and mature secreted cytokines in cell supernatants. Lysates were immunoblotted with anti-β-actin as a loading control. Data shown are representative of three independent experiments.
Anti Caspase 1, supplied by Abcam, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti caspase 1/product/Abcam
Average 98 stars, based on 1 article reviews
anti caspase 1 - by Bioz Stars, 2026-02
98/100 stars
  Buy from Supplier

93
Alomone Labs lot ant007an0702

Lot Ant007an0702, supplied by Alomone Labs, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lot ant007an0702/product/Alomone Labs
Average 93 stars, based on 1 article reviews
lot ant007an0702 - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology mouse monoclonal igg1 anti ace2 antibody

Mouse Monoclonal Igg1 Anti Ace2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mouse monoclonal igg1 anti ace2 antibody/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
mouse monoclonal igg1 anti ace2 antibody - by Bioz Stars, 2026-02
96/100 stars
  Buy from Supplier

95
R&D Systems polyclonal goat anti il 33
<t>IL-33</t> in hypothalamus was increased by chronic HFD feeding. a The brain sections were prepared from adult mice. The brain sections containing hypothalamic regions were subjected to double immunofluorescence <t>for</t> <t>IL-33</t> (green) with various glial markers (red) including Iba1 (microglia), GFAP (astrocytes), and Olig2 (OLGs). The nuclear counterstaining by DAPI (blue) was also conducted. The representative images were taken from hypothalamic ARC. The enlarged images from the insets indicated in the upper panel are included in the lower panel. Arrows shown in the lower panel indicate IL-33 + /GFAP + -astrocytes and IL-33 + /Olig2 + OLGs. b Total proteins were prepared from hypothalamus of the obese mice at 3 and 4 month after Chow or HFD feeding, and then subjected to western blot analysis (left-hand panel) to examine IL-33 protein expression. IL-33 protein levels were quantified (right-hand panel). c , d The brain tissue sections were prepared from the Chow- and HFD-fed groups at 4 month after feeding, and then subjected to immunofluorescence. The representative images were captured from ARC regions. Arrows indicate IL-33 + /GFAP + -astrocytes ( c ) or IL-33 + /Olig2 + -OLGs ( d ). The results shown in b are presented as mean ± SEM (n = 3 animals for each group at each time point). * p < 0.05, *** p < 0.001 versus the Chow group. Scale bar in a , d 50 μm; in c 100 μm
Polyclonal Goat Anti Il 33, supplied by R&D Systems, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal goat anti il 33/product/R&D Systems
Average 95 stars, based on 1 article reviews
polyclonal goat anti il 33 - by Bioz Stars, 2026-02
95/100 stars
  Buy from Supplier

98
Cell Signaling Technology Inc cleaved il 1β
(A) Structure of BAL-0028. (B-D) Comparison of BAL-0028 and MCC950 <t>in</t> <t>IL-1β</t> release assays from PMA differentiated THP-1 cells stimulated with LPS and (B) nigericin, (C) ATP, or (D) MSU. (E-I) Comparison of BAL-0028 and MCC950 in IL-1β release assays from LPS and nigericin stimulated human monocytes (E), iCell microglia (F), HMDM (G), iMacs (H), and human whole blood (I). (B-F,I) Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from independent experiments performed in triplicate; IC50 curve fitted by non-linear regression analysis. (G-H) Graph symbols show average values relative to vehicle control from independent experiments (indicated by different symbols) performed in triplicate +/− S.E.M. Compounds are shown in nanomolar (nM) concentrations. (B) N=73 for BAL-0028 and N=29 for MCC950, (C-E) N=2 (F,H) N=3, (G) N=3 donors, (I) N=4 donors.
Cleaved Il 1β, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cleaved il 1β/product/Cell Signaling Technology Inc
Average 98 stars, based on 1 article reviews
cleaved il 1β - by Bioz Stars, 2026-02
98/100 stars
  Buy from Supplier

93
Bio-Rad human il 1β ab
Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f <t>),</t> <t>IL-1β</t> + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse <t>IgG1,</t> clone <t>#2E8,</t> 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references
Human Il 1β Ab, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human il 1β ab/product/Bio-Rad
Average 93 stars, based on 1 article reviews
human il 1β ab - by Bioz Stars, 2026-02
93/100 stars
  Buy from Supplier

Image Search Results


Enhanced processing and secretion of IL-1β and IL-18 in stefin B-deficient BMDMs is caspase-1-dependent. BMDMs from WT and StB KO mice were primed for 4 h with LPS (100 ng/ml), washed, and stimulated with ATP for 20 min (5 mm) to activate the Nlrp3 inflammasome. Cell lysates and culture supernatants were immunoblotted with the indicated antibodies. Anti-caspase-1 and anti-caspase-11 antibodies recognized pro-caspase (inactive zymogen) and subunits generated by proteolytic cleavages. Anti-IL-1β and anti-IL-18 antibodies recognized inactive pro-form in cell extracts and mature secreted cytokines in cell supernatants. Lysates were immunoblotted with anti-β-actin as a loading control. Data shown are representative of three independent experiments.

Journal: The Journal of Biological Chemistry

Article Title: A Role for Stefin B (Cystatin B) in Inflammation and Endotoxemia *

doi: 10.1074/jbc.M114.609396

Figure Lengend Snippet: Enhanced processing and secretion of IL-1β and IL-18 in stefin B-deficient BMDMs is caspase-1-dependent. BMDMs from WT and StB KO mice were primed for 4 h with LPS (100 ng/ml), washed, and stimulated with ATP for 20 min (5 mm) to activate the Nlrp3 inflammasome. Cell lysates and culture supernatants were immunoblotted with the indicated antibodies. Anti-caspase-1 and anti-caspase-11 antibodies recognized pro-caspase (inactive zymogen) and subunits generated by proteolytic cleavages. Anti-IL-1β and anti-IL-18 antibodies recognized inactive pro-form in cell extracts and mature secreted cytokines in cell supernatants. Lysates were immunoblotted with anti-β-actin as a loading control. Data shown are representative of three independent experiments.

Article Snippet: Antibodies used in Western blotting were purchased from Abcam, and anti-caspase-1 (ab108362), anti-caspase-11 (ab10454), anti-IL-18 (ab71495), anti-stefin B (ab53725), anti-STAT1 (ab3987), anti-STAT1 Y 701 (9171S) were from Cell Signaling.

Techniques: Generated

Increased inflammasome activation in StB KO BMDMs is independent of lysosomal cysteine cathepsins. A, biosynthesis and integrity of lysosomes were studied by LysoTracker Green probe, as described under “Experimental Procedures.” The lysosomal fluorescence intensity was quantified upon LPS and ATP stimulations. Lysosomal destabilization was increased by ATP addition and was comparable between genotypes. Data were obtained from three independent biological experiments performed in triplicate, and the results are presented as means of geometric mean fluorescence intensity ± S.D. B, release of cathepsins into the cytosol and their activity were measured after indicated stimulations using fluorogenic substrates specific for cathepsins. Incubation of BMDMs with E-64d completely prevented cathepsin activity. C, BMDMs from WT and StB KO mice were primed for 4 h with LPS (100 ng/ml), washed, and stimulated with ATP for 20 min (5 mm) or primed with broad spectrum cysteine cathepsin inhibitor E-64d for 1 h (15 μm), followed by LPS and ATP stimulation. Cell lysates were immunoblotted with indicated antibodies. Lysates were immunoblotted with anti-β-actin as a loading control. Incubation of BMDMs with E-64d did not affect the processing of caspase-1 and pro-inflammatory cytokine release. Data shown are representative of three independent experiments. D, BMDMs were seeded into 96-well plates and stimulated as above. IL-1β release was quantified in the media by FlowCytomixTM. StB KO BMDMs secreted higher amounts of IL-1β into the media compared with the WT; however, priming with E-64d did not affect IL-1β release (n.s., nonsignificant difference). Data were obtained from four independent experiments performed in triplicate, and the results are presented as means ± S.D. *, p < 0.05; **, p < 0.01. E, viability of BMDMs was assessed by LDH release into the cell culture media upon inflammasome activation. The cytotoxicity was expressed as the percent of the total LDH release. Data were obtained from three independent experiments performed in triplicate, and the results are presented as means ± S.D. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Journal: The Journal of Biological Chemistry

Article Title: A Role for Stefin B (Cystatin B) in Inflammation and Endotoxemia *

doi: 10.1074/jbc.M114.609396

Figure Lengend Snippet: Increased inflammasome activation in StB KO BMDMs is independent of lysosomal cysteine cathepsins. A, biosynthesis and integrity of lysosomes were studied by LysoTracker Green probe, as described under “Experimental Procedures.” The lysosomal fluorescence intensity was quantified upon LPS and ATP stimulations. Lysosomal destabilization was increased by ATP addition and was comparable between genotypes. Data were obtained from three independent biological experiments performed in triplicate, and the results are presented as means of geometric mean fluorescence intensity ± S.D. B, release of cathepsins into the cytosol and their activity were measured after indicated stimulations using fluorogenic substrates specific for cathepsins. Incubation of BMDMs with E-64d completely prevented cathepsin activity. C, BMDMs from WT and StB KO mice were primed for 4 h with LPS (100 ng/ml), washed, and stimulated with ATP for 20 min (5 mm) or primed with broad spectrum cysteine cathepsin inhibitor E-64d for 1 h (15 μm), followed by LPS and ATP stimulation. Cell lysates were immunoblotted with indicated antibodies. Lysates were immunoblotted with anti-β-actin as a loading control. Incubation of BMDMs with E-64d did not affect the processing of caspase-1 and pro-inflammatory cytokine release. Data shown are representative of three independent experiments. D, BMDMs were seeded into 96-well plates and stimulated as above. IL-1β release was quantified in the media by FlowCytomixTM. StB KO BMDMs secreted higher amounts of IL-1β into the media compared with the WT; however, priming with E-64d did not affect IL-1β release (n.s., nonsignificant difference). Data were obtained from four independent experiments performed in triplicate, and the results are presented as means ± S.D. *, p < 0.05; **, p < 0.01. E, viability of BMDMs was assessed by LDH release into the cell culture media upon inflammasome activation. The cytotoxicity was expressed as the percent of the total LDH release. Data were obtained from three independent experiments performed in triplicate, and the results are presented as means ± S.D. *, p < 0.05; **, p < 0.01; ***, p < 0.001.

Article Snippet: Antibodies used in Western blotting were purchased from Abcam, and anti-caspase-1 (ab108362), anti-caspase-11 (ab10454), anti-IL-18 (ab71495), anti-stefin B (ab53725), anti-STAT1 (ab3987), anti-STAT1 Y 701 (9171S) were from Cell Signaling.

Techniques: Activation Assay, Fluorescence, Activity Assay, Incubation, Cell Culture

Journal: Cancer Cell

Article Title: Cancer-associated fibroblast phenotypes are associated with patient outcome in non-small cell lung cancer

doi: 10.1016/j.ccell.2023.12.021

Figure Lengend Snippet:

Article Snippet: Rabbit polyclonal anti-p75 (CD271); Clone (polyclonal_ANT-007); Lot(ANT007AN0702) , alomone labs , Cat#ANT-007; RRID: AB_2039968.

Techniques: Recombinant, Labeling, Software

Journal: Cell Reports

Article Title: Identification of presented SARS-CoV-2 HLA class I and HLA class II peptides using HLA peptidomics

doi: 10.1016/j.celrep.2021.109305

Figure Lengend Snippet:

Article Snippet: Cells were stained with mouse monoclonal IgG1 anti-ACE2 antibody (cat: sc-390851, clone E-11, lot: D2420, Santa Cruz) or anti-TMPRSS2 (cat: sc-515727, clone:H-4, lot:D2420), followed by Alexa Fluor® 488 AffiniPure Goat Anti-Mouse IgG (cat: 115-545-146, lot: 138610).

Techniques: Purification, Staining, Virus, Plasmid Preparation, Recombinant, Software

IL-33 in hypothalamus was increased by chronic HFD feeding. a The brain sections were prepared from adult mice. The brain sections containing hypothalamic regions were subjected to double immunofluorescence for IL-33 (green) with various glial markers (red) including Iba1 (microglia), GFAP (astrocytes), and Olig2 (OLGs). The nuclear counterstaining by DAPI (blue) was also conducted. The representative images were taken from hypothalamic ARC. The enlarged images from the insets indicated in the upper panel are included in the lower panel. Arrows shown in the lower panel indicate IL-33 + /GFAP + -astrocytes and IL-33 + /Olig2 + OLGs. b Total proteins were prepared from hypothalamus of the obese mice at 3 and 4 month after Chow or HFD feeding, and then subjected to western blot analysis (left-hand panel) to examine IL-33 protein expression. IL-33 protein levels were quantified (right-hand panel). c , d The brain tissue sections were prepared from the Chow- and HFD-fed groups at 4 month after feeding, and then subjected to immunofluorescence. The representative images were captured from ARC regions. Arrows indicate IL-33 + /GFAP + -astrocytes ( c ) or IL-33 + /Olig2 + -OLGs ( d ). The results shown in b are presented as mean ± SEM (n = 3 animals for each group at each time point). * p < 0.05, *** p < 0.001 versus the Chow group. Scale bar in a , d 50 μm; in c 100 μm

Journal: BMC Neuroscience

Article Title: Chronic exposure to high fat diet triggers myelin disruption and interleukin-33 upregulation in hypothalamus

doi: 10.1186/s12868-019-0516-6

Figure Lengend Snippet: IL-33 in hypothalamus was increased by chronic HFD feeding. a The brain sections were prepared from adult mice. The brain sections containing hypothalamic regions were subjected to double immunofluorescence for IL-33 (green) with various glial markers (red) including Iba1 (microglia), GFAP (astrocytes), and Olig2 (OLGs). The nuclear counterstaining by DAPI (blue) was also conducted. The representative images were taken from hypothalamic ARC. The enlarged images from the insets indicated in the upper panel are included in the lower panel. Arrows shown in the lower panel indicate IL-33 + /GFAP + -astrocytes and IL-33 + /Olig2 + OLGs. b Total proteins were prepared from hypothalamus of the obese mice at 3 and 4 month after Chow or HFD feeding, and then subjected to western blot analysis (left-hand panel) to examine IL-33 protein expression. IL-33 protein levels were quantified (right-hand panel). c , d The brain tissue sections were prepared from the Chow- and HFD-fed groups at 4 month after feeding, and then subjected to immunofluorescence. The representative images were captured from ARC regions. Arrows indicate IL-33 + /GFAP + -astrocytes ( c ) or IL-33 + /Olig2 + -OLGs ( d ). The results shown in b are presented as mean ± SEM (n = 3 animals for each group at each time point). * p < 0.05, *** p < 0.001 versus the Chow group. Scale bar in a , d 50 μm; in c 100 μm

Article Snippet: Polyclonal goat anti-IL-33 , R and D Systems Cat#AF3626, RRID:AB_884269 , Escherichia coli -derived recombinant mouse IL-33 , 1:200 (IF).

Techniques: Immunofluorescence, Western Blot, Expressing

IL-33 induces the morphologic change of oligodendrocytes. a Mature OLGs were exposed to 10 ng/ml of IL-33 for 24 h, and then subjected to immunofluorescence (red) using anti-MBP in accompany with DAPI nuclear counterstaining (blue). The interconnected network of OLG processes along with a small cell shape was injured after exposure to IL-33 (arrows). The complex network shape of OLGs in the control culture is indicated by arrowheads. In addition, MBP + -OLGs in the cultures treated with vehicle and IL-33 were quantified. The cell size of MBP + -OLGs was measured using NIH ImageJ analysis software. b Total proteins were prepared from the cultures treated with vehicle and IL-33. The samples were subjected to western blot analysis for the measurement of MBP. Data are presented as mean ± SEM of the three independent experiments. ** p < 0.01, *** p < 0.001 versus the vehicle group. Scale bar in a 50 μm

Journal: BMC Neuroscience

Article Title: Chronic exposure to high fat diet triggers myelin disruption and interleukin-33 upregulation in hypothalamus

doi: 10.1186/s12868-019-0516-6

Figure Lengend Snippet: IL-33 induces the morphologic change of oligodendrocytes. a Mature OLGs were exposed to 10 ng/ml of IL-33 for 24 h, and then subjected to immunofluorescence (red) using anti-MBP in accompany with DAPI nuclear counterstaining (blue). The interconnected network of OLG processes along with a small cell shape was injured after exposure to IL-33 (arrows). The complex network shape of OLGs in the control culture is indicated by arrowheads. In addition, MBP + -OLGs in the cultures treated with vehicle and IL-33 were quantified. The cell size of MBP + -OLGs was measured using NIH ImageJ analysis software. b Total proteins were prepared from the cultures treated with vehicle and IL-33. The samples were subjected to western blot analysis for the measurement of MBP. Data are presented as mean ± SEM of the three independent experiments. ** p < 0.01, *** p < 0.001 versus the vehicle group. Scale bar in a 50 μm

Article Snippet: Polyclonal goat anti-IL-33 , R and D Systems Cat#AF3626, RRID:AB_884269 , Escherichia coli -derived recombinant mouse IL-33 , 1:200 (IF).

Techniques: Immunofluorescence, Software, Western Blot

List of antibodies in the study for immunofluorescence or western blot analysis

Journal: BMC Neuroscience

Article Title: Chronic exposure to high fat diet triggers myelin disruption and interleukin-33 upregulation in hypothalamus

doi: 10.1186/s12868-019-0516-6

Figure Lengend Snippet: List of antibodies in the study for immunofluorescence or western blot analysis

Article Snippet: Polyclonal goat anti-IL-33 , R and D Systems Cat#AF3626, RRID:AB_884269 , Escherichia coli -derived recombinant mouse IL-33 , 1:200 (IF).

Techniques: Immunofluorescence, Western Blot, Purification, Affinity Chromatography, Recombinant, Derivative Assay

(A) Structure of BAL-0028. (B-D) Comparison of BAL-0028 and MCC950 in IL-1β release assays from PMA differentiated THP-1 cells stimulated with LPS and (B) nigericin, (C) ATP, or (D) MSU. (E-I) Comparison of BAL-0028 and MCC950 in IL-1β release assays from LPS and nigericin stimulated human monocytes (E), iCell microglia (F), HMDM (G), iMacs (H), and human whole blood (I). (B-F,I) Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from independent experiments performed in triplicate; IC50 curve fitted by non-linear regression analysis. (G-H) Graph symbols show average values relative to vehicle control from independent experiments (indicated by different symbols) performed in triplicate +/− S.E.M. Compounds are shown in nanomolar (nM) concentrations. (B) N=73 for BAL-0028 and N=29 for MCC950, (C-E) N=2 (F,H) N=3, (G) N=3 donors, (I) N=4 donors.

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: (A) Structure of BAL-0028. (B-D) Comparison of BAL-0028 and MCC950 in IL-1β release assays from PMA differentiated THP-1 cells stimulated with LPS and (B) nigericin, (C) ATP, or (D) MSU. (E-I) Comparison of BAL-0028 and MCC950 in IL-1β release assays from LPS and nigericin stimulated human monocytes (E), iCell microglia (F), HMDM (G), iMacs (H), and human whole blood (I). (B-F,I) Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from independent experiments performed in triplicate; IC50 curve fitted by non-linear regression analysis. (G-H) Graph symbols show average values relative to vehicle control from independent experiments (indicated by different symbols) performed in triplicate +/− S.E.M. Compounds are shown in nanomolar (nM) concentrations. (B) N=73 for BAL-0028 and N=29 for MCC950, (C-E) N=2 (F,H) N=3, (G) N=3 donors, (I) N=4 donors.

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Comparison, Control

(A-B) Effect of BAL-0028 and MCC950 on LDH release (A) and TNF release (B) from LPS and nigericin stimulated iMacs. (C, D) Comparison of BAL-0028 and MCC950 pretreatment in PMA-differentiated THP-1s on LPS-induced secretion of (C) TNF and (D) IL-6. (E-F) Effect of BAL-0028 and MCC950 treatment in PMA-differentiated THP-1s on (E) cytotoxicity (LDH release) and (F) and cell viability (CellTiter-Blue assay). (A-F) Bar chart symbols show average values relative to vehicle control from independent experiments (indicated by different symbols) performed in triplicate+/− S.E.M. (A-B) N=3. (C-F) N=2.

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: (A-B) Effect of BAL-0028 and MCC950 on LDH release (A) and TNF release (B) from LPS and nigericin stimulated iMacs. (C, D) Comparison of BAL-0028 and MCC950 pretreatment in PMA-differentiated THP-1s on LPS-induced secretion of (C) TNF and (D) IL-6. (E-F) Effect of BAL-0028 and MCC950 treatment in PMA-differentiated THP-1s on (E) cytotoxicity (LDH release) and (F) and cell viability (CellTiter-Blue assay). (A-F) Bar chart symbols show average values relative to vehicle control from independent experiments (indicated by different symbols) performed in triplicate+/− S.E.M. (A-B) N=3. (C-F) N=2.

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Comparison, CtB Assay, Control

(A) Western blot for caspase-1 and IL-1β cleavage, and NLRP3 expression from PMA differentiated THP-1 cells stimulated with LPS and nigericin in the presence of BAL-0028 or MCC950 (both 500 nM). (B) Comparison of BAL-0028 and MCC950 effects on ASC speck formation assessed by fluorescence microscopy in PMA differentiated THP-1 ASC-GFP cells stimulated with LPS and nigericin. (C) Comparison of BAL-0028 and MCC950 effects on ASC speck formation assessed by flow cytometry in HEK293T ASC-BFP cells transfected with human NLRP3 and stimulated with nigericin. (D-E) Effect of BAL-0028 and MCC950 on ASC speck formation assessed by fluorescence microscopy using an anti-ASC antibody in iMacs. (F-G) Effects of BAL-0028, MCC950, and VX-765 on IL-1β release from PMA differentiated THP-1 cells stimulated with (F) LPS and transfected with poly(dA:dT) or (G) protective antigen (PA) and Lfn-needle protein. (H) Effects of BAL-0028, MCC950 and VX-765 on IL-18 release from human keratinocytes stimulated with Talabostat. (A) Representative blots from N=2 independent experiments. (B) Average +/− S.E.M % ASC-GFP speck positive cells from N=2 independent experiments performed in triplicate. (C) Average +/− S.E.M change in nigericin induced ASC specks normalized to cells without compound treatment from N=3-4 independent experiments. (D,F-H) Graph symbols show average values relative to vehicle control from independent experiments performed in triplicate (indicated by different symbols) +/− S.E.M. (D,G,H) N=2 and (F) N=3. (E) Representative images from (D).

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: (A) Western blot for caspase-1 and IL-1β cleavage, and NLRP3 expression from PMA differentiated THP-1 cells stimulated with LPS and nigericin in the presence of BAL-0028 or MCC950 (both 500 nM). (B) Comparison of BAL-0028 and MCC950 effects on ASC speck formation assessed by fluorescence microscopy in PMA differentiated THP-1 ASC-GFP cells stimulated with LPS and nigericin. (C) Comparison of BAL-0028 and MCC950 effects on ASC speck formation assessed by flow cytometry in HEK293T ASC-BFP cells transfected with human NLRP3 and stimulated with nigericin. (D-E) Effect of BAL-0028 and MCC950 on ASC speck formation assessed by fluorescence microscopy using an anti-ASC antibody in iMacs. (F-G) Effects of BAL-0028, MCC950, and VX-765 on IL-1β release from PMA differentiated THP-1 cells stimulated with (F) LPS and transfected with poly(dA:dT) or (G) protective antigen (PA) and Lfn-needle protein. (H) Effects of BAL-0028, MCC950 and VX-765 on IL-18 release from human keratinocytes stimulated with Talabostat. (A) Representative blots from N=2 independent experiments. (B) Average +/− S.E.M % ASC-GFP speck positive cells from N=2 independent experiments performed in triplicate. (C) Average +/− S.E.M change in nigericin induced ASC specks normalized to cells without compound treatment from N=3-4 independent experiments. (D,F-H) Graph symbols show average values relative to vehicle control from independent experiments performed in triplicate (indicated by different symbols) +/− S.E.M. (D,G,H) N=2 and (F) N=3. (E) Representative images from (D).

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Western Blot, Expressing, Comparison, Fluorescence, Microscopy, Flow Cytometry, Transfection, Control

Effects of BAL-0028, MCC950 and VX-765 on LDH release from PMA differentiated THP-1 cells stimulated with (A) LPS and transfected with poly(dA:dT) or (B) protective antigen (PA) and Lfn-needle protein. Graph symbols show average values from independent experiments performed in triplicate (indicated by different symbols) +/− S.E.M. (A) N=3 and (B) N=2.

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: Effects of BAL-0028, MCC950 and VX-765 on LDH release from PMA differentiated THP-1 cells stimulated with (A) LPS and transfected with poly(dA:dT) or (B) protective antigen (PA) and Lfn-needle protein. Graph symbols show average values from independent experiments performed in triplicate (indicated by different symbols) +/− S.E.M. (A) N=3 and (B) N=2.

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Transfection

Comparison of BAL-0028 and MCC950 in IL-1β release assays from cells stimulated with LPS and nigericin. (A) J774A.1 mouse macrophage cell line, (B) Wistar Rat PBMCs, (C) Beagle CD14 + monocytes, (D) New Zealand white rabbit PBMC, African Green Monkey ( Chlorocebus sabaeus) PBMC (E) and CD14 + monocytes (F), (G) Cynomolgus monkey ( Macaca fascicularis) CD14 + monocytes, (H) wild-type 129S6 iBMDM and (I) 129S6-human promoter NLRP3 iBMDM. (A, H, I) Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from N=3 independent experiments performed in triplicate. (B-G) Graph symbols show average IL-1β values relative to vehicle control +/−S.D. from one experiment performed in duplicate (C, D,F) or triplicate (B, E, G,). IC50 curves fitted by non-linear regression analysis.

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: Comparison of BAL-0028 and MCC950 in IL-1β release assays from cells stimulated with LPS and nigericin. (A) J774A.1 mouse macrophage cell line, (B) Wistar Rat PBMCs, (C) Beagle CD14 + monocytes, (D) New Zealand white rabbit PBMC, African Green Monkey ( Chlorocebus sabaeus) PBMC (E) and CD14 + monocytes (F), (G) Cynomolgus monkey ( Macaca fascicularis) CD14 + monocytes, (H) wild-type 129S6 iBMDM and (I) 129S6-human promoter NLRP3 iBMDM. (A, H, I) Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from N=3 independent experiments performed in triplicate. (B-G) Graph symbols show average IL-1β values relative to vehicle control +/−S.D. from one experiment performed in duplicate (C, D,F) or triplicate (B, E, G,). IC50 curves fitted by non-linear regression analysis.

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Comparison, Control

(A-B) Comparison of BAL-0028 and MCC950 in LDH release assays from (A) wild-type 129S6 iBMDM and (B) 129S6-human promoter NLRP3 iBMDM cells stimulated with LPS and nigericin. Graph symbols show average LDH values +/− S.E.M. from N=3 independent experiments (indicated by different symbols) performed in triplicate. (C-D) Comparison of BAL-0028 and MCC950 in IL-1β release assays from (C) wild-type 129S6 and (D) 129S6-human promoter NLRP3 primary peritoneal macrophages stimulated with LPS and nigericin. Graph symbols show average IL-1β values relative to vehicle control +/−S.D. from one experiment performed in duplicate. IC50 curves fitted by non-linear regression analysis. (E) Multiple sequence alignment of human, African green monkey (AGM), Cynomolgus monkey (CYNO), dog, rabbit, mouse, and rat NLRP3 protein sequences restricted to the corresponding sequence of amino acids 131 – 694 in the human NACHT domain construct shown below the alignment.

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: (A-B) Comparison of BAL-0028 and MCC950 in LDH release assays from (A) wild-type 129S6 iBMDM and (B) 129S6-human promoter NLRP3 iBMDM cells stimulated with LPS and nigericin. Graph symbols show average LDH values +/− S.E.M. from N=3 independent experiments (indicated by different symbols) performed in triplicate. (C-D) Comparison of BAL-0028 and MCC950 in IL-1β release assays from (C) wild-type 129S6 and (D) 129S6-human promoter NLRP3 primary peritoneal macrophages stimulated with LPS and nigericin. Graph symbols show average IL-1β values relative to vehicle control +/−S.D. from one experiment performed in duplicate. IC50 curves fitted by non-linear regression analysis. (E) Multiple sequence alignment of human, African green monkey (AGM), Cynomolgus monkey (CYNO), dog, rabbit, mouse, and rat NLRP3 protein sequences restricted to the corresponding sequence of amino acids 131 – 694 in the human NACHT domain construct shown below the alignment.

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Comparison, Control, Sequencing, Construct

(A) Comparison of BAL-0598, BAL-0028, and MCC950 in an IL-1β release assay in primary peritoneal macrophages isolated from 129S6 mouse promoter- NLRP3 mice stimulated with LPS and ATP. Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from N=2 independent experiments performed in duplicate. (B-C) Levels of IL-1β (B) and IL-6 (C) in the peritoneal lavage fluid of 129S6 mouse promoter- NLRP3 mice after peritonitis induced by LPS and ATP in the presence of increasing amounts of BAL-0598. Graph symbols show values from individual mice +/− S.D. (D) Average IL-1β release values +/− S.D. in PLF from mice treated with BAL-0598 prior to peritonitis, ED50 curve fitted by non-linear regression analysis. (E) IL-1β release values in PLF from individual mice treated with BAL-0598 prior to peritonitis plotted against corresponding plasma levels of unbound BAL-0598, IC50 and IC90 curve fitted by non- linear regression analysis. (F) Comparison of BAL-0028 and MCC950 (40-1000 nM) in a cell death assay in U937 cells expressing NLRP3 or NLRP3-AID mutants (D303H, A352V, L353P, K565E, E567G, K568N, G569R, Y570C) stimulated with LPS and nigericin. Graph symbols show average area under the curve (AUC) values relative to DMSO vehicle control for each cell type +/− S.E.M. from N=2-4 independent experiments performed in duplicate.

Journal: bioRxiv

Article Title: Discovery of a Potent and Selective Inhibitor of Human NLRP3 with a Novel Binding Modality and Mechanism of Action

doi: 10.1101/2024.12.21.629867

Figure Lengend Snippet: (A) Comparison of BAL-0598, BAL-0028, and MCC950 in an IL-1β release assay in primary peritoneal macrophages isolated from 129S6 mouse promoter- NLRP3 mice stimulated with LPS and ATP. Graph symbols show average IL-1β values relative to vehicle control +/− S.E.M. from N=2 independent experiments performed in duplicate. (B-C) Levels of IL-1β (B) and IL-6 (C) in the peritoneal lavage fluid of 129S6 mouse promoter- NLRP3 mice after peritonitis induced by LPS and ATP in the presence of increasing amounts of BAL-0598. Graph symbols show values from individual mice +/− S.D. (D) Average IL-1β release values +/− S.D. in PLF from mice treated with BAL-0598 prior to peritonitis, ED50 curve fitted by non-linear regression analysis. (E) IL-1β release values in PLF from individual mice treated with BAL-0598 prior to peritonitis plotted against corresponding plasma levels of unbound BAL-0598, IC50 and IC90 curve fitted by non- linear regression analysis. (F) Comparison of BAL-0028 and MCC950 (40-1000 nM) in a cell death assay in U937 cells expressing NLRP3 or NLRP3-AID mutants (D303H, A352V, L353P, K565E, E567G, K568N, G569R, Y570C) stimulated with LPS and nigericin. Graph symbols show average area under the curve (AUC) values relative to DMSO vehicle control for each cell type +/− S.E.M. from N=2-4 independent experiments performed in duplicate.

Article Snippet: Membranes were then incubated with one of the following primary antibodies: NLRP3 (Cell Signaling; 15101), cleaved IL-1β (Cell Signaling; 12242), cleaved CASP1 (Cell Signaling; 4199) and actin (Sigma; A2066).

Techniques: Comparison, Release Assay, Isolation, Control, Expressing

Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Studies on anti-cytokine treatments in experimental and human stroke

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification